View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_low_44 (Length: 240)
Name: NF3485_low_44
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_low_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 14 - 139
Target Start/End: Original strand, 39292080 - 39292209
Alignment:
| Q |
14 |
tcatcaccgggtgtagccatcatatacctgttttacaacatcaatcgtgtatgtc----attaattaattaatacatctttatgtgtaaactttcaagat |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39292080 |
tcatcaccgggtgtagccatcatatacctgttttacaacatcaatcgtgtatgtcattaattaattaattaatacatctttatgtgtaaactttgaagat |
39292179 |
T |
|
| Q |
110 |
ttgagtaattgagattcatttaaaacatta |
139 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39292180 |
atgagtaattgagattcatttaaaacatta |
39292209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University