View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_low_45 (Length: 239)
Name: NF3485_low_45
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_low_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 50 - 211
Target Start/End: Complemental strand, 46081999 - 46081838
Alignment:
| Q |
50 |
cagtcttctgatgcatattttgattcataaccagcttaagaaagaaggaagaaggaatgaatacgagatgcataagttgctagccttgaatcagagacaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46081999 |
cagtcttctgatgcatattttgattcataaccagcttaagaaagaaggaagaaggaatgaatacgagatgcataagttgctagccttgaatcagagacaa |
46081900 |
T |
 |
| Q |
150 |
aagatggtgagttgatttaaatcacttgctgctgtggtctattttatgttgttcatctcact |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46081899 |
aagatggtgagttgatttaaatcacttgctgctgtggtctattttatgctgttcatctcact |
46081838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 80 - 157
Target Start/End: Original strand, 27960029 - 27960106
Alignment:
| Q |
80 |
ccagcttaagaaagaaggaagaaggaatgaatacgagatgcataagttgctagccttgaatcagagacaaaagatggt |
157 |
Q |
| |
|
||||||||| |||||||| || | ||||||||| |||| ||||||| || |||| |||||||||||| ||||||||| |
|
|
| T |
27960029 |
ccagcttaaaaaagaagggaggaagaatgaatatgagaggcataagctgttagcgttgaatcagagaacaaagatggt |
27960106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University