View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_low_52 (Length: 236)
Name: NF3485_low_52
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_low_52 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 236
Target Start/End: Original strand, 46081641 - 46081860
Alignment:
| Q |
15 |
cctgtgtataaaacaataaattaccagttattagtaagctcacgaaatatgaaaaagaagtacatgacccaatagatcttctaacccatagtttcacgag |
114 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46081641 |
cctgtgtataaaaaaataaattaccagttattagtaagctcacgaaatatgaaaaagaagtacatgacccaatagatcttctaacccatagtttcacgag |
46081740 |
T |
 |
| Q |
115 |
aggaagcccttcgagattccagaagttctttcagccttttagtggccaatgaggcttcttctgtcttcctttgcaatacctgcaataaacatataataaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
46081741 |
aggaagcccttcgagattccagaagttctttcagccttttagtggccaatgaagcttcttctgttttcctttgcaatacctgcaataaac--ataataaa |
46081838 |
T |
 |
| Q |
215 |
gtgagatgaacaacataaaata |
236 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
46081839 |
gtgagatgaacagcataaaata |
46081860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 104 - 195
Target Start/End: Complemental strand, 27960272 - 27960181
Alignment:
| Q |
104 |
agtttcacgagaggaagcccttcgagattccagaagttctttcagccttttagtggccaatgaggcttcttctgtcttcctttgcaatacct |
195 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||||||||| |||||||| || ||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
27960272 |
agtttcacgtgaggaagcctttcgagattccaaaagttcttttagcctttttgtagccaaggatgcttcttctgtcttcctttgcaacacct |
27960181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University