View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3485_low_55 (Length: 231)
Name: NF3485_low_55
Description: NF3485
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3485_low_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 216
Target Start/End: Original strand, 41220126 - 41220327
Alignment:
| Q |
15 |
catagggtgcatgcatgatatgatcgtatgatagattactataagcattgaaaagatgcatgcataaatgaataattaaattaagtgaaagagaacataa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41220126 |
catagggtgcatgcatgatatgatcgtatgatagattactataagcattgaaaagatgcatgcataaatgaataattaaattaagtgaaagagaacataa |
41220225 |
T |
|
| Q |
115 |
ggttaccctgtcaacaatgtcagcatgattagggttacggttagggcggcttcgttgctcaaccaaccaaccatcaggaaccttcaacggtgaccggata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
41220226 |
ggttaccctgtcaacaatgtcagcatgattagggttacggttagggcggcttcgttgctcaaccaaccaaccatcaggaagcttcaacggtgaccggata |
41220325 |
T |
|
| Q |
215 |
ac |
216 |
Q |
| |
|
|| |
|
|
| T |
41220326 |
ac |
41220327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University