View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3486_low_3 (Length: 420)
Name: NF3486_low_3
Description: NF3486
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3486_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 315 - 399
Target Start/End: Complemental strand, 50176943 - 50176859
Alignment:
| Q |
315 |
caggaaataggttgtgagatcccagcaaataagcaatgtttgggnnnnnnncaatgacaagaaaacatatcaccatgtgcatttg |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50176943 |
caggaaataggttgtgagatcccagcaaataagcaatgtgtgggaaaaaaacaatgacaagaaaacatatcaccatgtgcatttg |
50176859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University