View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3487_low_3 (Length: 477)

Name: NF3487_low_3
Description: NF3487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3487_low_3
NF3487_low_3
[»] chr1 (2 HSPs)
chr1 (15-461)||(23996305-23996739)
chr1 (244-331)||(6724314-6724401)
[»] chr3 (2 HSPs)
chr3 (18-327)||(45967579-45967888)
chr3 (15-175)||(38456531-38456691)
[»] chr5 (1 HSPs)
chr5 (200-362)||(32251555-32251717)
[»] chr2 (1 HSPs)
chr2 (66-139)||(21579443-21579516)
[»] chr7 (1 HSPs)
chr7 (198-403)||(25107271-25107476)
[»] scaffold0233 (1 HSPs)
scaffold0233 (126-174)||(11305-11353)


Alignment Details
Target: chr1 (Bit Score: 394; Significance: 0; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 394; E-Value: 0
Query Start/End: Original strand, 15 - 461
Target Start/End: Original strand, 23996305 - 23996739
Alignment:
15 ctgtggtggaggaatatttttctgttgcgtgaggaggggtggtttaacaaccatgttagtcgctctgttcgtgacggtattaataccctatgttggactg 114  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
23996305 ctgtggtggaggaatatttttctgttgcgtgaggagggatggtttaacaaccatgttagtcgctctgttcgtgacggtattaataccctctgttggactg 23996404  T
115 atgtttgcgtgggtggtgtgtcgtttcgggataggtttagtagattatttgagttgtcgactttgaaaggggggagtgtatctgcgatgtgcaatttagg 214  Q
    ||||||||||||||||||||||||||            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23996405 atgtttgcgtgggtggtgtgtcgttt------------agtagattatttgagttgtcgactttgaaaggggggagtgtatctgcgatgtgcaatttagg 23996492  T
215 ttgggggagagatggtggagcgttgcagcggaggcgtaggctgtttgcttgggaggagaagttggtggggtaaattagccttttgcttgataatgttaat 314  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23996493 ttgggggagagatggtggagcgttgcagcggaggcgtaggctgtttgcttgggaggagaagttggtggggtaaattagccttttgcttgataatgttaat 23996592  T
315 ttgcaggtcactaaggaagacagttggttatggtggttggattcatctcctatgtatattgtctgtagtgcttataagtttttgaatgatcaacttaacc 414  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23996593 ttgcaggtcactaaggaagacagttggttatggtggttggattcatctcctatgtatattgtctgtagtgcttataagtttttgaatgatcaacttaacc 23996692  T
415 atgtagctgaagtccaattaccttcttttatgcataatgatgttcct 461  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||    
23996693 atgtagctgaagtccaattaccttcttttatgcataatgatattcct 23996739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 244 - 331
Target Start/End: Complemental strand, 6724401 - 6724314
Alignment:
244 ggaggcgtaggctgtttgcttgggaggagaagttggtggggtaaattagccttttgcttgataatgttaatttgcaggtcactaagga 331  Q
    ||||||| ||| ||||||| ||||||||| ||||||||||| ||||||   |  |||||  |||||||||||||||||| | ||||||    
6724401 ggaggcggaggttgtttgcgtgggaggaggagttggtgggggaaattaaattactgcttcttaatgttaatttgcaggttaataagga 6724314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 54; Significance: 8e-22; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 54; E-Value: 8e-22
Query Start/End: Original strand, 18 - 327
Target Start/End: Complemental strand, 45967888 - 45967579
Alignment:
18 tggtggaggaatatttttctgttgcgtgaggaggggtggtttaacaaccatgttagtcgctctgttcgtgacggtattaataccctatgttggactgatg 117  Q
    ||||||||| | |||| ||||||||||||||| |  ||||| || | ||| ||||||| ||||||| | |||  || |||||| || | |||||||||||    
45967888 tggtggagggacatttgtctgttgcgtgaggatgtttggttcaatagccacgttagtcactctgttggcgacaataataatactcttttttggactgatg 45967789  T
118 tttgcgtgggtggtgtgtcgtttcgggataggtttagtagattatttgagttgtcgactttgaaaggggggagtgtatctgcgatgtgcaatttaggttg 217  Q
    |||| |||||||||||||| ||  |||| |  |||||| | |||||||| || |||||  |||| | ||  |  || |||||| |||||| |||||| ||    
45967788 tttgggtgggtggtgtgtctttaagggacatatttagtcgtttatttgaattatcgacgctgaaggaggaaacagtgtctgcggtgtgcagtttagggtg 45967689  T
218 ggggagagatggtggagcgttgcagcggaggcgtaggctgtttgcttgggaggagaagttggtggggtaaattagccttttgcttgataatgttaatttg 317  Q
    ||||  |||||||||||||| |||  |||| |||||  ||||| | ||||||||| ||||||| ||  || |||| ||||| ||||| ||  |||| |||    
45967688 ggggttagatggtggagcgtggcattggagacgtagattgttttcctgggaggaggagttggtaggagaacttaggcttttacttgaaaacattaacttg 45967589  T
318 caggtcacta 327  Q
    ||||| ||||    
45967588 caggttacta 45967579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 38456691 - 38456531
Alignment:
15 ctgtggtggaggaatatttttctgttgcgtgaggaggggtggtttaacaaccatgttagtcgctctgttcgtgacggtattaataccctatgttggactg 114  Q
    |||||||||||| | |||| || | || ||||||| || ||||||||||  |||||||| || |||||| || | || |  ||||| || | |||||| |    
38456691 ctgtggtggagggacatttatcagctgtgtgaggaaggatggtttaacagtcatgttagccgttctgttggtaatggcaaaaatactctcttttggacgg 38456592  T
115 atgtttgcgtgggtggtgtgtcgtttcgggataggtttagtagattatttgagttgtcgac 175  Q
    ||||||| |||||||| |||||||| |  || |||||||||||||||||| | ||||||||    
38456591 atgtttgggtgggtggagtgtcgttacatgacaggtttagtagattatttcaattgtcgac 38456531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 200 - 362
Target Start/End: Original strand, 32251555 - 32251717
Alignment:
200 gatgtgcaatttaggttgggggagagatggtggagcgttgcagcggaggcgtaggctgtttgcttgggaggagaagttggtggggtaaattagccttttg 299  Q
    |||||| |||||||| ||||||| |||||| || || | | |  |||| |||||||||||||| ||||||||| ||||||| ||| || |||| | |||     
32251555 gatgtgtaatttagggtgggggatagatggaggtgcttggaattggagacgtaggctgtttgcgtgggaggaggagttggtaggggaacttaggccttta 32251654  T
300 cttgataatgttaatttgcaggtcactaaggaagacagttggttatggtggttggattcatct 362  Q
    ||||| ||||| | ||||||||| ||||  ||||| || ||||| ||| | |||||| |||||    
32251655 cttgacaatgtaactttgcaggttactagagaagatagatggttgtggagtttggatccatct 32251717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 66 - 139
Target Start/End: Complemental strand, 21579516 - 21579443
Alignment:
66 catgttagtcgctctgttcgtgacggtattaataccctatgttggactgatgtttgcgtgggtggtgtgtcgtt 139  Q
    |||||||| ||||| ||| | |||| | ||||||| || | ||||||||||||||| |||||||||||||||||    
21579516 catgttagccgctccgttggcgacgattttaatactcttttttggactgatgtttgggtgggtggtgtgtcgtt 21579443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 198 - 403
Target Start/End: Complemental strand, 25107476 - 25107271
Alignment:
198 gcgatgtgcaatttaggttgggggagagatggtggagcgttgcagcggaggcgtaggctgtttgcttgggaggagaagttggtggggtaaattagccttt 297  Q
    |||||||||  |||||| ||||||  |||||||||||||| ||   || | |||||  ||||||| ||||||||| ||||||| |   || |||| ||||    
25107476 gcgatgtgcggtttagggtgggggttagatggtggagcgtggctttggtgacgtagattgtttgcatgggaggagcagttggtagaagaacttagacttt 25107377  T
298 tgcttgataatgttaatttgcaggtcactaaggaagacagttggttatggtggttggattcatctcctatgtatattgtctgtagtgcttataagttttt 397  Q
    | ||||| ||  |||| |||||||| |||| | | || || ||||| ||| | |||||||||||| |||  || | |||  ||||||| || ||||||||    
25107376 tacttgaaaacattaacttgcaggttactaggaacgatagatggttgtggagattggattcatcttctagttacactgttcgtagtgcctacaagttttt 25107277  T
398 gaatga 403  Q
    ||||||    
25107276 gaatga 25107271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0233 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0233
Description:

Target: scaffold0233; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 126 - 174
Target Start/End: Original strand, 11305 - 11353
Alignment:
126 ggtggtgtgtcgtttcgggataggtttagtagattatttgagttgtcga 174  Q
    ||||||||||| ||| | || |||||||| |||||||||||||||||||    
11305 ggtggtgtgtcctttagagacaggtttagcagattatttgagttgtcga 11353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University