View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3487_low_5 (Length: 338)
Name: NF3487_low_5
Description: NF3487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3487_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 9 - 259
Target Start/End: Complemental strand, 35802363 - 35802113
Alignment:
| Q |
9 |
tgttttactatctgtggcgcccgatgcagcgactgcttttatgggtgttttgattttctttgctctgcaaaatgcaggccataatctcaaatggcttatt |
108 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35802363 |
tgttttactatctgtagcgcccgatgcagcgactgcttttatgggtgttttgattttctttgctctgcaaaatgcaggccataatctcaaatggcttatt |
35802264 |
T |
 |
| Q |
109 |
gcaagttttgaactagaaagtagataagaattcaaaaggtaaaaattcagtttaagtgctactaaatatggcagacgtacttgcaaataacttttatgct |
208 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35802263 |
gcaagttttaaactagaaagtagataagaattcaaagggtaaaagttcagtttaagtgctactaaatattgcagacgtacttgcaaataacttttatgct |
35802164 |
T |
 |
| Q |
209 |
accaatatcaataagtgaacttctctcttacctttattttggattgattaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35802163 |
accaatatcaataagtgaacttctctcttacctttagtttggattgattaa |
35802113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 258 - 331
Target Start/End: Complemental strand, 35802051 - 35801978
Alignment:
| Q |
258 |
aaatggactgctactattttggtttggaaatatgaactttactcttaaccattccattatattttacctatgct |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35802051 |
aaatggactgctactattttggtttggaaatatgaactttactcttaaccattccattatattttacctatgct |
35801978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 4e-23; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 43 - 102
Target Start/End: Original strand, 56046963 - 56047022
Alignment:
| Q |
43 |
gcttttatgggtgttttgattttctttgctctgcaaaatgcaggccataatctcaaatgg |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
56046963 |
gcttttatgggtgttttgattttctttgctctgcaaaatgcaggccatactctcaaatgg |
56047022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University