View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3487_low_8 (Length: 233)
Name: NF3487_low_8
Description: NF3487
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3487_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 33 - 202
Target Start/End: Original strand, 9486655 - 9486821
Alignment:
| Q |
33 |
atgtctttcattcaggaccttaaatagactacatggagcatgagataaatggagtatacctgatctcagttaatagcatgagatttcttgtcattt-cct |
131 |
Q |
| |
|
|||||||||||| |||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
9486655 |
atgtctttcatt---gaccctaaatggactaaatggagcatgagataaatggagtatacctgatctc-gttaatagcatgagatttcttgtcattttcct |
9486750 |
T |
 |
| Q |
132 |
tcaagttacattcaaagtatttttgttcttaccacccatattttattggtttgttatctctggtggtatca |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9486751 |
tcaagttacattcaaagtatttatgttcttaccacccatattttattggtttgttatttctggtggtatca |
9486821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University