View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3488_high_23 (Length: 324)

Name: NF3488_high_23
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3488_high_23
NF3488_high_23
[»] chr4 (4 HSPs)
chr4 (125-313)||(48416940-48417128)
chr4 (19-130)||(48416806-48416917)
chr4 (19-78)||(48422058-48422117)
chr4 (38-119)||(48410500-48410581)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 9e-98; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 125 - 313
Target Start/End: Original strand, 48416940 - 48417128
Alignment:
125 ccccatattgccctgttaccataaaatcaagataacaaatgtcaactgcttttgtcatgaatcaaataaattcctttttaacatatgaagattggaagct 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48416940 ccccatattgccctgttaccataaaatcaagataacaaatgtcaactgcttttgtcatgaatcaaataaattcctttttaacatatgaagattggaagct 48417039  T
225 taattgaaatgtctccaagctttgatgtaaaaacattttaaacagcagatggcaaatgagatgcatacaaactcaacaaagatctgatg 313  Q
    ||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
48417040 taattgaaatgtctcaaagctttgatgtaaaaacatttcaaacagcagatggcaaatgagatgcatacaaactcaacaaagatctgatg 48417128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 130
Target Start/End: Original strand, 48416806 - 48416917
Alignment:
19 agtgtgcatcaaatttaagtggaattgcagatatgagtgggctttctagagtcatcacggttgccttttgaactgcagagacaacatcaactcctctttt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48416806 agtgtgcatcaaatttaagtggaattgcagatatgagtgggctttctagagtcatcacggttgccttttgaactgcagagacaacatcaactcctctttt 48416905  T
119 ctcactccccat 130  Q
    ||||||||||||    
48416906 ctcactccccat 48416917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 48422058 - 48422117
Alignment:
19 agtgtgcatcaaatttaagtggaattgcagatatgagtgggctttctagagtcatcacgg 78  Q
    ||||||||||||||||||||||| ||||||||||| |||| || ||||||||||||||||    
48422058 agtgtgcatcaaatttaagtggatttgcagatatgggtggactctctagagtcatcacgg 48422117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 38 - 119
Target Start/End: Original strand, 48410500 - 48410581
Alignment:
38 tggaattgcagatatgagtgggctttctagagtcatcacggttgccttttgaactgcagagacaacatcaactcctcttttc 119  Q
    |||||||||||||||| ||||||| | ||| ||| | |  |||||| |||||||||  |||||||| |||||||||||||||    
48410500 tggaattgcagatatgtgtgggctctgtagtgtctttattgttgccctttgaactgtggagacaacgtcaactcctcttttc 48410581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University