View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3488_low_12 (Length: 444)
Name: NF3488_low_12
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3488_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 392; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 1 - 404
Target Start/End: Original strand, 52113095 - 52113498
Alignment:
| Q |
1 |
tgagttggtcgtgttttggttcggttggatcaaggtaagagaggatacggtaaccaccagtgagttctgttgacggcatgaaagttccggtgaagaggtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113095 |
tgagttggtcgtgttttggttcggttggatcaaggtaagagaggatacggtaaccaccagtgagttctgttgacggcatgaaagttccggtgaagaggtc |
52113194 |
T |
 |
| Q |
101 |
acgtttttcaactttggaattgtcgaagagaacagggaatgattttccgtcaagtaaaacaatgacgtttgggtttgaggaaatgaatgggcctggtggc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52113195 |
acgtttttcaactttggaattgtcgaagagaacagggaatgattttccgtcaagtaaaacaatgacgtttgggttagaggaaatgaatgggcctggtggc |
52113294 |
T |
 |
| Q |
201 |
atattagcgcgaaaaatggttgatttgtatttgtgcattttacttctgaaatatttgtcgcggccgccttcgttgtagaaatattcaagacggtctttga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113295 |
atattagcgcgaaaaatggttgatttgtatttgtgcattttgcttctgaaatatttgtcgcggccgccttcgttgtagaaatattcaagacggtctttga |
52113394 |
T |
 |
| Q |
301 |
taggacctacgaatgggaggccgtaatctccagggattcttcgcattgaaagttttttgggtggttcgggtgaaactaatgacgatgttgtgtctgtgcc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113395 |
taggacctacgaatgggaggccgtaatctccagggattcttcgcattggaagttttttgggtggttcgggtgaaactaatgacgatgttgtgtctgtgcc |
52113494 |
T |
 |
| Q |
401 |
ggac |
404 |
Q |
| |
|
|||| |
|
|
| T |
52113495 |
ggac |
52113498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 169 - 202
Target Start/End: Complemental strand, 12505235 - 12505202
Alignment:
| Q |
169 |
ttgggtttgaggaaatgaatgggcctggtggcat |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
12505235 |
ttgggtttgaggaaatgaatggacctggtggcat |
12505202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University