View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3488_low_15 (Length: 399)

Name: NF3488_low_15
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3488_low_15
NF3488_low_15
[»] chr8 (5 HSPs)
chr8 (63-284)||(9336587-9336802)
chr8 (296-383)||(9336168-9336255)
chr8 (54-184)||(8209354-8209484)
chr8 (314-383)||(8209157-8209226)
chr8 (314-361)||(9937755-9937802)
[»] chr1 (2 HSPs)
chr1 (54-186)||(42365179-42365311)
chr1 (314-378)||(42364910-42364974)


Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 5)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 63 - 284
Target Start/End: Complemental strand, 9336802 - 9336587
Alignment:
63 atgggaggatcgtctttttcatgtgaactggaaagtgggaagtgaggcgaatattgatttggcttctttctgtaactccatcaccgatcctaaggaccct 162  Q
    |||| ||||| |||||||||||  ||||||| | ||| ||||||| |||||||| |||||||||||| ||||||| ||||||| ||||||||||||||||    
9336802 atggaaggatagtctttttcattcgaactgggaggtgcgaagtgaagcgaatatcgatttggcttctatctgtaaatccatcatcgatcctaaggaccct 9336703  T
163 cgcatcattgaattcggttagtgtttctgtttttggccagttagggtttttgcgttttacagtgatgtgatttgggtggagtttgaattttgaattttgt 262  Q
    |||||| ||||||||||||| |||||| ||||||||  || |||||||||||| ||| ||      ||||||||||||||||| ||| ||||||| | ||    
9336702 cgcatccttgaattcggttaatgtttcagtttttgg-taggtagggtttttgcttttaac-----ggtgatttgggtggagttagaactttgaatctggt 9336609  T
263 aggtcaatttttcaaaaagact 284  Q
    |||||| ||| |||||||||||    
9336608 aggtcattttctcaaaaagact 9336587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 296 - 383
Target Start/End: Complemental strand, 9336255 - 9336168
Alignment:
296 gaatgttgatgtgcagttgaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataataattt 383  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9336255 gaatgttgatgtgcagttgaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataataattt 9336168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 54 - 184
Target Start/End: Complemental strand, 8209484 - 8209354
Alignment:
54 gaaacttacatgggaggatcgtctttttcatgtgaactggaaagtgggaagtgaggcgaatattgatttggcttctttctgtaactccatcaccgatcct 153  Q
    ||||||| |||||||||||||||||| |||   ||||||||||||  ||| ||| || ||||| ||||| |||||| ||| | |||||||||||||||||    
8209484 gaaacttgcatgggaggatcgtctttctcacaagaactggaaagtcagaaatgacgccaatatcgatttagcttctctctttcactccatcaccgatcct 8209385  T
154 aaggaccctcgcatcattgaattcggttagt 184  Q
    || || ||||||||   | ||||||||||||    
8209384 aacgatcctcgcattcgtcaattcggttagt 8209354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 314 - 383
Target Start/End: Complemental strand, 8209226 - 8209157
Alignment:
314 gaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataataattt 383  Q
    ||||||||||||||| ||||||||||||||||  |||||||||||||| || | |||||||| |||||||    
8209226 gaaggcacttgatgcattgattgcttacttgcatgctgcagatgctgacgctgcgaggtgatcataattt 8209157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 314 - 361
Target Start/End: Complemental strand, 9937802 - 9937755
Alignment:
314 gaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctga 361  Q
    ||||||||| ||||||||||||||||||||||||| ||||||||||||    
9937802 gaaggcactcgatgcgttgattgcttacttgcgagatgcagatgctga 9937755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 54 - 186
Target Start/End: Complemental strand, 42365311 - 42365179
Alignment:
54 gaaacttacatgggaggatcgtctttttcatgtgaactggaaagtgggaagtgaggcgaatattgatttggcttctttctgtaactccatcaccgatcct 153  Q
    ||||||| |||||||||||||||||| |||    |||||||||||| ||| ||| || ||||||||| |||||||| ||||| |||| ||||||||||||    
42365311 gaaacttccatgggaggatcgtctttctcacaaaaactggaaagtgcgaaatgaagccaatattgatctggcttctctctgtgactcaatcaccgatcct 42365212  T
154 aaggaccctcgcatcattgaattcggttagtgt 186  Q
    || ||||||||||||  ||||||||||||||||    
42365211 aaagaccctcgcatccgtgaattcggttagtgt 42365179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 314 - 378
Target Start/End: Complemental strand, 42364974 - 42364910
Alignment:
314 gaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataat 378  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||| ||  | ||||||||||    
42364974 gaaggcacttgatgcattgattgcttacttgcgagctgcagatgctgacgctagcaggtgataat 42364910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University