View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3488_low_15 (Length: 399)
Name: NF3488_low_15
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3488_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 90; Significance: 2e-43; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 63 - 284
Target Start/End: Complemental strand, 9336802 - 9336587
Alignment:
| Q |
63 |
atgggaggatcgtctttttcatgtgaactggaaagtgggaagtgaggcgaatattgatttggcttctttctgtaactccatcaccgatcctaaggaccct |
162 |
Q |
| |
|
|||| ||||| ||||||||||| ||||||| | ||| ||||||| |||||||| |||||||||||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
9336802 |
atggaaggatagtctttttcattcgaactgggaggtgcgaagtgaagcgaatatcgatttggcttctatctgtaaatccatcatcgatcctaaggaccct |
9336703 |
T |
|
| Q |
163 |
cgcatcattgaattcggttagtgtttctgtttttggccagttagggtttttgcgttttacagtgatgtgatttgggtggagtttgaattttgaattttgt |
262 |
Q |
| |
|
|||||| ||||||||||||| |||||| |||||||| || |||||||||||| ||| || ||||||||||||||||| ||| ||||||| | || |
|
|
| T |
9336702 |
cgcatccttgaattcggttaatgtttcagtttttgg-taggtagggtttttgcttttaac-----ggtgatttgggtggagttagaactttgaatctggt |
9336609 |
T |
|
| Q |
263 |
aggtcaatttttcaaaaagact |
284 |
Q |
| |
|
|||||| ||| ||||||||||| |
|
|
| T |
9336608 |
aggtcattttctcaaaaagact |
9336587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 296 - 383
Target Start/End: Complemental strand, 9336255 - 9336168
Alignment:
| Q |
296 |
gaatgttgatgtgcagttgaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataataattt |
383 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9336255 |
gaatgttgatgtgcagttgaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataataattt |
9336168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 54 - 184
Target Start/End: Complemental strand, 8209484 - 8209354
Alignment:
| Q |
54 |
gaaacttacatgggaggatcgtctttttcatgtgaactggaaagtgggaagtgaggcgaatattgatttggcttctttctgtaactccatcaccgatcct |
153 |
Q |
| |
|
||||||| |||||||||||||||||| ||| |||||||||||| ||| ||| || ||||| ||||| |||||| ||| | ||||||||||||||||| |
|
|
| T |
8209484 |
gaaacttgcatgggaggatcgtctttctcacaagaactggaaagtcagaaatgacgccaatatcgatttagcttctctctttcactccatcaccgatcct |
8209385 |
T |
|
| Q |
154 |
aaggaccctcgcatcattgaattcggttagt |
184 |
Q |
| |
|
|| || |||||||| | |||||||||||| |
|
|
| T |
8209384 |
aacgatcctcgcattcgtcaattcggttagt |
8209354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 314 - 383
Target Start/End: Complemental strand, 8209226 - 8209157
Alignment:
| Q |
314 |
gaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataataattt |
383 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||| || | |||||||| ||||||| |
|
|
| T |
8209226 |
gaaggcacttgatgcattgattgcttacttgcatgctgcagatgctgacgctgcgaggtgatcataattt |
8209157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 314 - 361
Target Start/End: Complemental strand, 9937802 - 9937755
Alignment:
| Q |
314 |
gaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctga |
361 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9937802 |
gaaggcactcgatgcgttgattgcttacttgcgagatgcagatgctga |
9937755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 2e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 54 - 186
Target Start/End: Complemental strand, 42365311 - 42365179
Alignment:
| Q |
54 |
gaaacttacatgggaggatcgtctttttcatgtgaactggaaagtgggaagtgaggcgaatattgatttggcttctttctgtaactccatcaccgatcct |
153 |
Q |
| |
|
||||||| |||||||||||||||||| ||| |||||||||||| ||| ||| || ||||||||| |||||||| ||||| |||| |||||||||||| |
|
|
| T |
42365311 |
gaaacttccatgggaggatcgtctttctcacaaaaactggaaagtgcgaaatgaagccaatattgatctggcttctctctgtgactcaatcaccgatcct |
42365212 |
T |
|
| Q |
154 |
aaggaccctcgcatcattgaattcggttagtgt |
186 |
Q |
| |
|
|| |||||||||||| |||||||||||||||| |
|
|
| T |
42365211 |
aaagaccctcgcatccgtgaattcggttagtgt |
42365179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 314 - 378
Target Start/End: Complemental strand, 42364974 - 42364910
Alignment:
| Q |
314 |
gaaggcacttgatgcgttgattgcttacttgcgagctgcagatgctgatgcggggaggtgataat |
378 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||| || | |||||||||| |
|
|
| T |
42364974 |
gaaggcacttgatgcattgattgcttacttgcgagctgcagatgctgacgctagcaggtgataat |
42364910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University