View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3488_low_22 (Length: 336)
Name: NF3488_low_22
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3488_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 52 - 325
Target Start/End: Original strand, 14504924 - 14505197
Alignment:
| Q |
52 |
tagtgaattttgaagacaattgtggaattaatcaattgtcaataggtaaagagagcatgcgtgaaggctgaagggtggataagcctattgtgggaaagtg |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14504924 |
tagtgaattttgaagacaattgtggaattaatcaattgtcaataggtaaagagtgcatgcgtgaaggctgaagggtggataagcctattgtgggaaagtg |
14505023 |
T |
 |
| Q |
152 |
cctctatttaatgcatagttgtggaaattaattaaaggcaaaatttagatgcattttcttgtataactgcggaatatagacatgcatgttacagctgaat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14505024 |
cctctatttaatgcatagttgtggaaattaattaaaggcaatatttagatgcattttcttgtataactgcggaatatggacatgcatgttacagctgaat |
14505123 |
T |
 |
| Q |
252 |
aggtttccatatgcatgattgattgcacattttgtcagagaagaacgtgggtctttgtttattacaaatgatga |
325 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14505124 |
aggtttctatatgcatgattgattacacattttgtcagagaagaacgtgggtctttgtttattacaaatgatga |
14505197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University