View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3488_low_24 (Length: 324)
Name: NF3488_low_24
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3488_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 9e-98; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 125 - 313
Target Start/End: Original strand, 48416940 - 48417128
Alignment:
| Q |
125 |
ccccatattgccctgttaccataaaatcaagataacaaatgtcaactgcttttgtcatgaatcaaataaattcctttttaacatatgaagattggaagct |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48416940 |
ccccatattgccctgttaccataaaatcaagataacaaatgtcaactgcttttgtcatgaatcaaataaattcctttttaacatatgaagattggaagct |
48417039 |
T |
|
| Q |
225 |
taattgaaatgtctccaagctttgatgtaaaaacattttaaacagcagatggcaaatgagatgcatacaaactcaacaaagatctgatg |
313 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48417040 |
taattgaaatgtctcaaagctttgatgtaaaaacatttcaaacagcagatggcaaatgagatgcatacaaactcaacaaagatctgatg |
48417128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 19 - 130
Target Start/End: Original strand, 48416806 - 48416917
Alignment:
| Q |
19 |
agtgtgcatcaaatttaagtggaattgcagatatgagtgggctttctagagtcatcacggttgccttttgaactgcagagacaacatcaactcctctttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48416806 |
agtgtgcatcaaatttaagtggaattgcagatatgagtgggctttctagagtcatcacggttgccttttgaactgcagagacaacatcaactcctctttt |
48416905 |
T |
|
| Q |
119 |
ctcactccccat |
130 |
Q |
| |
|
|||||||||||| |
|
|
| T |
48416906 |
ctcactccccat |
48416917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 48422058 - 48422117
Alignment:
| Q |
19 |
agtgtgcatcaaatttaagtggaattgcagatatgagtgggctttctagagtcatcacgg |
78 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||| || |||||||||||||||| |
|
|
| T |
48422058 |
agtgtgcatcaaatttaagtggatttgcagatatgggtggactctctagagtcatcacgg |
48422117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 38 - 119
Target Start/End: Original strand, 48410500 - 48410581
Alignment:
| Q |
38 |
tggaattgcagatatgagtgggctttctagagtcatcacggttgccttttgaactgcagagacaacatcaactcctcttttc |
119 |
Q |
| |
|
|||||||||||||||| ||||||| | ||| ||| | | |||||| ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
48410500 |
tggaattgcagatatgtgtgggctctgtagtgtctttattgttgccctttgaactgtggagacaacgtcaactcctcttttc |
48410581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University