View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3488_low_28 (Length: 278)
Name: NF3488_low_28
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3488_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 16 - 261
Target Start/End: Complemental strand, 2434441 - 2434196
Alignment:
| Q |
16 |
attgttacatgaatctaaagttacactttttattgcttttatttaaaatggaaggagtatactctttattcaagtaaagtcctccacaaacatgtgcaaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2434441 |
attgttacatgaatctaaagttacactttttattgcttttatttaaaatggaaggagtatactctttattcaagtaaagtcctccacaaacatgtgcaaa |
2434342 |
T |
 |
| Q |
116 |
atgtgcaaatgtgtaatgttaacccaacctgtaataaattcattgcacatagcatggtagcttttaggaaccatacacgttacattagagaggttgttct |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2434341 |
atgtgcaaatgtgtaatgttaacccaacctgtaataaattcgttgcacatagcatggtagcttttaggaaccatacacgttacattagagaggttgttct |
2434242 |
T |
 |
| Q |
216 |
atacccctctagctaaaataacgataccacaaggcagtgtaatact |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2434241 |
atacccctctagctaaaataacgataccacaaggcaatgtaatact |
2434196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University