View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3488_low_31 (Length: 251)
Name: NF3488_low_31
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3488_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 23998166 - 23998385
Alignment:
| Q |
18 |
cttttaactcatctaacctttttgactgatttcttcgttcatagtcctatatacacatgtgaataacgagctatatgctgattttctgatcattatctca |
117 |
Q |
| |
|
||||||||| |||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23998166 |
cttttaacttatctcacccttttgactgatttcttcgttcatagtcctatatacacatgtgaataacgagctatatgctgattttctgatcattatctta |
23998265 |
T |
 |
| Q |
118 |
tcttctattgaagtaagttaccacatatccaagcacaatcattggctgcatattcctccccaggaacaagggagaagagatatcagatattgatttatgt |
217 |
Q |
| |
|
|||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23998266 |
tcttttattgaagtaagttaccacttatcgaagcacaatcattggctgcatattcctccccaggaacaagggagaagagatatcagatattgatttatgt |
23998365 |
T |
 |
| Q |
218 |
taggatttaagagtcctatg |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
23998366 |
taggatttaagagtcctatg |
23998385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 135 - 224
Target Start/End: Original strand, 24005967 - 24006056
Alignment:
| Q |
135 |
ttaccacatatccaagcacaatcattggctgcatattcctccccaggaacaagggagaagagatatcagatattgatttatgttaggatt |
224 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
24005967 |
ttaccacatatacaagcacaatcgttggctgcatattcctccccaagaacaagggagaggagatatcagatattggtttatgttaggatt |
24006056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University