View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3488_low_34 (Length: 239)
Name: NF3488_low_34
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3488_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 9335566 - 9335370
Alignment:
| Q |
1 |
tctatagtttgtgaactgacgtgagtttaggaattgagtttatagaacatgatgaaagtatattgtagagccccgtttatgctagagcacacaaaaatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9335566 |
tctatagtttgtgaactgacgtgagtttaggaattgagtttatagaacatgatgaaagtatattgtagagccccgtttatgctagaacacacaaaaatgt |
9335467 |
T |
|
| Q |
101 |
tgcatattgcatatttacgaggttttgaaacttttgaattcaattagtctttatttctttcattgccccaatatacaaatgatccatattttatggc |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9335466 |
tgcatattgcatatttacgaggttatgaaacttttgaattcaattagtctttttttctttcattgccccaatatacaaatgatccatattttatggc |
9335370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University