View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3488_low_35 (Length: 232)
Name: NF3488_low_35
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3488_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 147 - 216
Target Start/End: Complemental strand, 50667998 - 50667929
Alignment:
| Q |
147 |
cttctcattttacgaaaaccattataatagttaaaagaagagttacttactgaatctcgaacaacaagag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50667998 |
cttctcattttacgaaaaccattataatagttaaaagaagagttacttactgaatctcgaacaacaagag |
50667929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 54
Target Start/End: Complemental strand, 50668130 - 50668095
Alignment:
| Q |
19 |
atcaaaaagtgagtgtctcttatgatagttaaattg |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50668130 |
atcaaaaagtgagtgtctcttatgatagttaaattg |
50668095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University