View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3488_low_36 (Length: 201)

Name: NF3488_low_36
Description: NF3488
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3488_low_36
NF3488_low_36
[»] chr3 (1 HSPs)
chr3 (101-182)||(40889473-40889554)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 101 - 182
Target Start/End: Original strand, 40889473 - 40889554
Alignment:
101 acttgattctgcacacaaaagaaccttactaacccctttctacttttcaaataaaagtaaatcatataactatgctattggt 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40889473 acttgattctgcacacaaaagaaccttactaacccctttctacttttcaaataaaagtaaatcatataactatgctattggt 40889554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University