View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3489_high_17 (Length: 277)
Name: NF3489_high_17
Description: NF3489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3489_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 74 - 242
Target Start/End: Complemental strand, 39917423 - 39917253
Alignment:
| Q |
74 |
tctctatatctttctctctct--atatatacagaatccataccacttcctgtatttaattccagtatttttaatttagaatatgtctttatctgttctcc |
171 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917423 |
tctctatatctttctctctctctatatatacagaatccataccacttcctgtatttaattccagtatttttaatttagaatatgtctttatctgttctcc |
39917324 |
T |
 |
| Q |
172 |
tttcctttatatggtttcacttttatgctttctctcactaccgcttctaaagtatttcctctaatacaata |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39917323 |
tttcctttatatggtttcacttttatgctttctctcactaccgcttctaaagtatttcctctaatacaata |
39917253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University