View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3489_low_2 (Length: 418)

Name: NF3489_low_2
Description: NF3489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3489_low_2
NF3489_low_2
[»] chr1 (3 HSPs)
chr1 (252-408)||(3153893-3154049)
chr1 (102-182)||(3154253-3154332)
chr1 (9-68)||(3154366-3154425)


Alignment Details
Target: chr1 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 252 - 408
Target Start/End: Complemental strand, 3154049 - 3153893
Alignment:
252 atataagtaataatcaaaatgaaataagattttggatatttaggttttatgagaagcttaaaaatgatgacaaacgtaagaaagttaaatgtattattac 351  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||    
3154049 atataagtaataatcaaaatgaaataagattttggatatttaggttttatgagaagcttaaaaatgatgacaaacataagaaagttaaatatattattac 3153950  T
352 ctactttttggatgattttttaaattacatggacaaaattgaggtactatggagtgt 408  Q
    |||||||||||||||||||||||||||||||||||||||||| ||| |||| |||||    
3153949 ctactttttggatgattttttaaattacatggacaaaattgaagtattatgaagtgt 3153893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 102 - 182
Target Start/End: Complemental strand, 3154332 - 3154253
Alignment:
102 gataagttgggatcacactcaaagtgcagttgcttttgttttacatgccatgcaatcatttgtttaggtaacggtttgcaa 182  Q
    |||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||| || | |||||||||    
3154332 gataagttgggatcacactcaaagtgtagttgc-tttgttttacatgccatgcaatcatttgcttaagtgatggtttgcaa 3154253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 9 - 68
Target Start/End: Complemental strand, 3154425 - 3154366
Alignment:
9 caagaatatggaaaattggggaggaggcacatgatcttgttgtgagtgagatgactggtg 68  Q
    |||||||||||||||||||| ||||| ||||||||||||||||||||| |||||||||||    
3154425 caagaatatggaaaattgggaaggagccacatgatcttgttgtgagtgtgatgactggtg 3154366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University