View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3489_low_2 (Length: 418)
Name: NF3489_low_2
Description: NF3489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3489_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 2e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 252 - 408
Target Start/End: Complemental strand, 3154049 - 3153893
Alignment:
| Q |
252 |
atataagtaataatcaaaatgaaataagattttggatatttaggttttatgagaagcttaaaaatgatgacaaacgtaagaaagttaaatgtattattac |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
3154049 |
atataagtaataatcaaaatgaaataagattttggatatttaggttttatgagaagcttaaaaatgatgacaaacataagaaagttaaatatattattac |
3153950 |
T |
|
| Q |
352 |
ctactttttggatgattttttaaattacatggacaaaattgaggtactatggagtgt |
408 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||| ||||| |
|
|
| T |
3153949 |
ctactttttggatgattttttaaattacatggacaaaattgaagtattatgaagtgt |
3153893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 102 - 182
Target Start/End: Complemental strand, 3154332 - 3154253
Alignment:
| Q |
102 |
gataagttgggatcacactcaaagtgcagttgcttttgttttacatgccatgcaatcatttgtttaggtaacggtttgcaa |
182 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||| ||| || | ||||||||| |
|
|
| T |
3154332 |
gataagttgggatcacactcaaagtgtagttgc-tttgttttacatgccatgcaatcatttgcttaagtgatggtttgcaa |
3154253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 9 - 68
Target Start/End: Complemental strand, 3154425 - 3154366
Alignment:
| Q |
9 |
caagaatatggaaaattggggaggaggcacatgatcttgttgtgagtgagatgactggtg |
68 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
3154425 |
caagaatatggaaaattgggaaggagccacatgatcttgttgtgagtgtgatgactggtg |
3154366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University