View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3489_low_28 (Length: 231)
Name: NF3489_low_28
Description: NF3489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3489_low_28 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 231
Target Start/End: Complemental strand, 10436372 - 10436154
Alignment:
| Q |
13 |
gaaacatctttggagaaaatgattcatcaaagatcatccaccacctgatttggtctagttagtgaatatggcttctctctttgtggggccctgcatgcaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
10436372 |
gaaacatctttggagaaaatgattcatcaaagatcatccaccacctgatttggtctagttagtgaatatggcttctctctttgtggagccctacatgcaa |
10436273 |
T |
|
| Q |
113 |
ttggaaggacttctttaccaaagcatcacttcaacaacgtagaccataggctagtgaatttggattattttccagctcatctgagatatttcatgttctc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10436272 |
ttggaaggacttctttaccaaagcatcacttcaacaacatagaccataggctagtgaatttggattattttccagctcatatgagatatttcatgttctc |
10436173 |
T |
|
| Q |
213 |
aagttgttgtcaaatatgt |
231 |
Q |
| |
|
|||||||||| |||||||| |
|
|
| T |
10436172 |
aagttgttgtaaaatatgt |
10436154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University