View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3489_low_31 (Length: 220)
Name: NF3489_low_31
Description: NF3489
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3489_low_31 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 32435115 - 32435334
Alignment:
| Q |
1 |
aatagcacaagatgaaatatttggacctgttatggcactttctaagttcaagtaagtataatttatatttctttttcgtcatcttagtcatgattttaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32435115 |
aatagcacaagatgaaatatttggacctgttatggcactttctaagttcaagtaagtataatttatatttctttttcgtcatcttagtcatgattttaaa |
32435214 |
T |
 |
| Q |
101 |
ctagagttgcaatagtatcaaaattttaaatatcatagaaaatcacggtcaaatatagttcgagttaaagtcacagagacatctaaaatcaccgacactt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32435215 |
ctagagttgcaatagtatcaaaattttaaatatcatagaaaatcacggtcaaatatagttcgagttaaagtcgcagagacatctaaaatcaccgacactt |
32435314 |
T |
 |
| Q |
201 |
tatattgaagcatgtttgat |
220 |
Q |
| |
|
|||||||||| |||| |||| |
|
|
| T |
32435315 |
tatattgaagaatgtctgat |
32435334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 57
Target Start/End: Complemental strand, 32406589 - 32406534
Alignment:
| Q |
2 |
atagcacaagatgaaatatttggacctgttatggcactttctaagttcaagtaagt |
57 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||| |||||||||||||| |
|
|
| T |
32406589 |
atagcacaagatgaaatatttggccctgtcatggcactcatgaagttcaagtaagt |
32406534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University