View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3490_high_1 (Length: 291)
Name: NF3490_high_1
Description: NF3490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3490_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 4 - 269
Target Start/End: Original strand, 33442811 - 33443076
Alignment:
| Q |
4 |
aaggagaaaggtggtattctccaacgtattcacgaaactcacagcaagtatattcctcttcagtatccattgctcttcccgtttggtgaagatcagtacc |
103 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
33442811 |
aaggagaaaggtggttttctccaacgtattcatgaaactcacagcaagtacattcctcttcagtatccattgctcttcccgtttggcgaggatcagtacc |
33442910 |
T |
|
| Q |
104 |
atgaacatattgaacgtaataaggtgacctctactggatctgttaagaaaaggattcgcattagtattcgtgagtttgttgcctatcggttgcaggagag |
203 |
Q |
| |
|
| |||||||||||||| || || |||||||||||||||||||||||||||| ||||| || ||| |||||||||||||||||||||| || |||||||| |
|
|
| T |
33442911 |
aagaacatattgaacgcaacgagttgacctctactggatctgttaagaaaagaattcgtatcagtgttcgtgagtttgttgcctatcgtttacaggagag |
33443010 |
T |
|
| Q |
204 |
aactattgaggactctgttttattttctggcaagcggcttttccagcaatttgtcgttgatatgta |
269 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
33443011 |
gactattgaagactctgttttattttccggcaagcggcttttccagcaatttattgttgatatgta |
33443076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University