View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3491_low_10 (Length: 201)

Name: NF3491_low_10
Description: NF3491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3491_low_10
NF3491_low_10
[»] chr6 (1 HSPs)
chr6 (16-112)||(953363-953456)


Alignment Details
Target: chr6 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 16 - 112
Target Start/End: Original strand, 953363 - 953456
Alignment:
16 cagaaaactgataatagggttttgaatggatttttgatattttatatccccacttttctgaagtttgttacaaaacccacgggcctctcttgaatgg 112  Q
    |||||||||||||||||||||||||||||||||| |||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
953363 cagaaaactgataatagggttttgaatggattttcgatat---atatccccacttttctgaagtttgttacaaaacccacgggcctctcttgaatgg 953456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University