View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3491_low_4 (Length: 253)
Name: NF3491_low_4
Description: NF3491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3491_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 32843144 - 32842894
Alignment:
| Q |
1 |
attagatatatggagggtcatagagctcacctatgttaggaatatacaggaagaattggaccaaacacctgacgctttgtgcccccaaaaagtatctctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
32843144 |
attagatatatggagggtcatagagctcgcctatgttaggaatatacaggaagaattggaccaaacacctgacgctttatgcccccaaaaagtatttctt |
32843045 |
T |
 |
| Q |
101 |
attacgaggaaaagaaagttgaactttaacgtccatcatttaatccctatccctcttgttaatttgagattatcccatttctaccccttcagataggtaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32843044 |
attacgaggaaaagaaagttgaactttaacgtccatcatttaatccctatccctcttgttaatttgagattattccatttctaccccttcagataggtaa |
32842945 |
T |
 |
| Q |
201 |
attatgtttctcattcacaaatccttctttctttatgttcttctctctcga |
251 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| ||| ||||||| |
|
|
| T |
32842944 |
cttatgtttctcattcacaaacccttctttctttatgttgttcactctcga |
32842894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University