View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3491_low_8 (Length: 214)
Name: NF3491_low_8
Description: NF3491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3491_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 1e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 8931144 - 8931329
Alignment:
| Q |
1 |
cagaattcacatagctcagagatgatatctaaggcacccatattttgttaaacaaaccaagaggacaatggttgctgaaattagattaagt---aataaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8931144 |
cagaattcacatagctcagagatgatatctaaggcacccatattttgttaaacaaaccaagaggacaatggttgctgaaattagattaagtacaaataaa |
8931243 |
T |
 |
| Q |
98 |
caatagagaaaaaagtacgtgtatataaatctatgcatgatggatttggcaatgcatgatcacattaatgaacttcttggcatggctttcgctagaaggt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8931244 |
caatagagaaaaaagtacgtgtatataaaaat-----------------caatgcatgatcacattaatgaacttcttggcatggctttcgctagaaggt |
8931326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University