View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3491_low_9 (Length: 202)
Name: NF3491_low_9
Description: NF3491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3491_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 12 - 186
Target Start/End: Complemental strand, 41751880 - 41751706
Alignment:
| Q |
12 |
gaagaatataacataattgatattagaaattaacaaggtagatnnnnnnnttgcagttttcaactacaacccagggatgagcaccgttgttcaggtatac |
111 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41751880 |
gaagtatataaccgaattgatattagaaattaacaaggtagataaaaaaattgcagttttcaactacaacccagggatgagcaccgttgttcaggtatac |
41751781 |
T |
|
| Q |
112 |
aaagatgactatgatcattgcactatcaaagataccatctacacatacttcagagggaactctagtgttactttg |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41751780 |
aaagatgactatgatcattgcactatcaaagataccatctacacatacttcagagggaactctagtgttactttg |
41751706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University