View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3492_high_24 (Length: 322)
Name: NF3492_high_24
Description: NF3492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3492_high_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 6625969 - 6626273
Alignment:
| Q |
1 |
ttccttcattgcacacaatgctccagtttctctgcaaggaatgaaaatatgtttcagggatgccagatgagaaagagaaaagtgaatagctcaaactggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6625969 |
ttccttcattgcacacaatgctccagtttctctgcaaggaatgaaaatatgtttcagagatgccagatgagaaagagaaaagtgaatagctcaaactggt |
6626068 |
T |
|
| Q |
101 |
tgcctaactttggtacacatacctattagtggcaacataaacacttccaaaagtacctcgccctataagtttacccttttgccattgacttttcatagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6626069 |
tgcctaactttggtacacatacctattagtggcaacataaacacttccaaaagtacctcgccctataagtttacccttttgccattgacttttcatagat |
6626168 |
T |
|
| Q |
201 |
aaggactctgtcttagccactccaggttgagaataggtagcattggcagagggtgaaggtaaggaagttccaggccaaggaggcaagggtaaggggtgaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
6626169 |
aaggactctgtcttagccactccaggttgagaataggtagcattggcagagggtgaaggtaaggaagttccaggccaaggaggcaagggtaacgggtgaa |
6626268 |
T |
|
| Q |
301 |
cactg |
305 |
Q |
| |
|
||||| |
|
|
| T |
6626269 |
cactg |
6626273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University