View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3492_high_33 (Length: 264)
Name: NF3492_high_33
Description: NF3492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3492_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 43407822 - 43408057
Alignment:
| Q |
1 |
aattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgnnnnnnnnnnnnnnnnnnnnnnatcaagcagatata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43407822 |
aattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgggaggaggaggaggag------atcaagcagatata |
43407915 |
T |
 |
| Q |
101 |
attgaggagctcttgggagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaactacgccacaatcacaatacatgtccaaca |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43407916 |
attgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaactacgccacaatcacaatacatgtccaaca |
43408015 |
T |
 |
| Q |
201 |
ataataatattcctatgggaatgggagagggagatcacttca |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43408016 |
ataataatattcctatgggaatgggagagggagatcacttca |
43408057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University