View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3492_low_33 (Length: 264)

Name: NF3492_low_33
Description: NF3492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3492_low_33
NF3492_low_33
[»] chr5 (1 HSPs)
chr5 (1-242)||(43407822-43408057)


Alignment Details
Target: chr5 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 43407822 - 43408057
Alignment:
1 aattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgnnnnnnnnnnnnnnnnnnnnnnatcaagcagatata 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                      ||||||||||||||    
43407822 aattataaggatggaatatggtggtgggttagtggctgacggtggtgtgtttggaccgatggtgggaggaggaggaggag------atcaagcagatata 43407915  T
101 attgaggagctcttgggagaaggttgctggattgaagcaagtgagaacagtttgatgtccatgcagcaaactacgccacaatcacaatacatgtccaaca 200  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||    
43407916 attgaggagctgttgggagaaggttgctggattgaagcaagtgagaatagtttgatggccatgcagcaaactacgccacaatcacaatacatgtccaaca 43408015  T
201 ataataatattcctatgggaatgggagagggagatcacttca 242  Q
    ||||||||||||||||||||||||||||||||||||||||||    
43408016 ataataatattcctatgggaatgggagagggagatcacttca 43408057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University