View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3492_low_38 (Length: 250)
Name: NF3492_low_38
Description: NF3492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3492_low_38 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 934386 - 934613
Alignment:
| Q |
13 |
aatatctaaggatatgcacataaattttgtccnnnnnnnnatccttcttaaagataagaatttccaaccatatagtaccttctagggtttggagagtttg |
112 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
934386 |
aatatctaaggatatgcacataagttttgtccttttttt-atccttcttagcgataagaatttccaatcatatagtgtcttctagggtttggagagttta |
934484 |
T |
 |
| Q |
113 |
atttgggtgtatagtgtcttctctcatccgtcttcatcgtgtttcacctctgttgagtgtttcagtttgtttcttacttgaattttccgtaaagttttct |
212 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
934485 |
atttgagtgtatagtgtcttctctcatccgtcttcatcgtgtttcacctc-------tgtttcagtttgtttcttacttgaattctctgtaaagttttca |
934577 |
T |
 |
| Q |
213 |
tccacatttgatgtttactctcccctctcaattttgtt |
250 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
934578 |
tccacatttgatgttta--ctcccctctcaattttgtt |
934613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University