View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3492_low_39 (Length: 249)

Name: NF3492_low_39
Description: NF3492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3492_low_39
NF3492_low_39
[»] chr7 (1 HSPs)
chr7 (14-249)||(42661485-42661722)


Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 249
Target Start/End: Complemental strand, 42661722 - 42661485
Alignment:
14 agattcaacatggaaaaactacgaaaagaatcataacgaaggaaaagcaacttcaatatgatnnnnnnn--tcctactatggagatgataggaatgatca 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         || ||||||||||||||||||||||||||    
42661722 agattcaacatggaaaaactacgaaaagaatcataacgaaggaaaagcaacttcaatatgataaaaaaaaatcatactatggagatgataggaatgatca 42661623  T
112 gctactacaagcaccttggatgcaaaaccttgcaacaatattgcatattttttagtgtcaacgagagtattacatatatgattacttataaaaccctaac 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
42661622 gctactacaagcaccttggatgcaaaaccttgcaacaatattgcattttttttagtgtcaacgagagtattacatatatgattacttataaaaccctaac 42661523  T
212 tcaaaagccccaaaaattgtaataggaccacgcaactc 249  Q
    ||||||||||||||||||||||||||||||||||||||    
42661522 tcaaaagccccaaaaattgtaataggaccacgcaactc 42661485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University