View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3492_low_43 (Length: 239)
Name: NF3492_low_43
Description: NF3492
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3492_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 934620 - 934786
Alignment:
| Q |
1 |
ttaattgggaatgaaatcattatggactattatgtgtcatgtgaacaaataatgtttgacagatactctatgcgtcttatggattgttcaacctctaaaa |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |||||||||||||||||||||||||| |
|
|
| T |
934620 |
ttaattggaaatgaaatcattatggactattatgtgtcatgtgaacaaataatgtttgacagttattctatgcatcttatggattgttcaacctctaaaa |
934719 |
T |
 |
| Q |
101 |
tacgtcgatcaagagatataatccaatgtaagatatgttgattgaattttatcttttaataaatttt |
167 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||| || ||||||||| ||||||||| |
|
|
| T |
934720 |
tacgtcgatcaagagatataatccaatctaagatatgttgattggatcttatcttttgataaatttt |
934786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 174 - 220
Target Start/End: Original strand, 934824 - 934870
Alignment:
| Q |
174 |
tttgagcaaagcggagagatgcgtagaacaaatacgataaagtaggt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
934824 |
tttgagcaaagcggagagatgcgtagaacaaatactataaagtaggt |
934870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University