View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3493_high_6 (Length: 429)
Name: NF3493_high_6
Description: NF3493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3493_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 1 - 411
Target Start/End: Original strand, 6354571 - 6354958
Alignment:
| Q |
1 |
ttacattgttatattgatcaatttcctattaagttg---ggtattttgatgggtgccaatctaaggagagttgatacttggaagcctattgtgtcgtcgt |
97 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354571 |
ttacattgttatattgatcattttcctattaagttgttcggtattttgatgggtgccaatctaaggagagttgatacttggaagcctattgtgtcgtcgt |
6354670 |
T |
 |
| Q |
98 |
tgatgaaaatgttgtctacttgttggaaaagtagacaattgtcaattagagagagtctgactttgattaactcagaattttcaatgatggtgttgagtct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354671 |
tgatgaaaatgttgtctacttgttggaaaagtagacaattgtcaattagagagagtctgactttgattaactcagaattttcaatgatggtgttgagtct |
6354770 |
T |
 |
| Q |
198 |
attgaagaagtggtggaggagatacaagtgtggtcgtgggagtggactaggactatgtacaggttccatctgtctctccctgtatgttctatgaatggtc |
297 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6354771 |
attgaagaa--------------------gtggtcgtgggagtgga------ctatgtacaagttccatctgcctctccctgtatgttctatgaatggtc |
6354844 |
T |
 |
| Q |
298 |
gtggaatccacgagattgtatcctgcgattgaccattgtttggtgttgtggacagtggggcggttcaccttgtttccttgtggttggtctgtgtgcgggt |
397 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6354845 |
gtggaatccacgagattgtatcctgcgattgaccattgtttggtgttgtggacagtggggcggttcaccttgtttccttgtggttggtctgtgtgcgggt |
6354944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University