View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3493_low_18 (Length: 295)
Name: NF3493_low_18
Description: NF3493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3493_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 68 - 278
Target Start/End: Complemental strand, 45505214 - 45505004
Alignment:
| Q |
68 |
atatttatttaatgacaacgttcgtatcaacaaacaatagaggcagcgagacaaaaagtaaaataaaatcagaaatttaactagaattatccatatgtaa |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45505214 |
atatttatttaatgacaacgttcgtatcaacaaacaatagaggcagcgagacaaaaagtaaaataaaatcagaaatttaactagaattatccatatgtaa |
45505115 |
T |
|
| Q |
168 |
atcatatttggctaaattatcaaactattctattgacttcacaaaaaatatgagacaataactaatgcttatctcattaactagcaagaaacaatgatac |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45505114 |
atcatatttggctaaattatcaaactattctattgacttcacaaaaaatatgagacaataagtaatgcttatctcattatttagcaagaaacaatgatac |
45505015 |
T |
|
| Q |
268 |
ctaatgctaca |
278 |
Q |
| |
|
|||| |||||| |
|
|
| T |
45505014 |
ctaaggctaca |
45505004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 30 - 239
Target Start/End: Original strand, 19849630 - 19849841
Alignment:
| Q |
30 |
ctaaaagcctttagaaat-atgacaatgctcgnnnnnnnatatttatttaatgacaacg-ttcgtatcaacaaacaatagaggcagcgagacaaaaagta |
127 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| ||||||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19849630 |
ctaaaagcctctagaaatcatgacaatgctcgtttttttatatttattcaatgacaacggttcgtatcaacaaacaatagaggaagcgagacaaaaagta |
19849729 |
T |
|
| Q |
128 |
aaataaaatcagaaatttaactagaattatccatatgtaaatcatatttggctaaattatcaaactattctattgacttcacaaaaaatatgagacaata |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19849730 |
aaataaaatcagaaatttaactagaattatccatatgtaaatcatatttggctaaattatcaaactattctattgacttcacagaaaatatgagacaata |
19849829 |
T |
|
| Q |
228 |
actaatgcttat |
239 |
Q |
| |
|
| |||||||||| |
|
|
| T |
19849830 |
agtaatgcttat |
19849841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 230 - 278
Target Start/End: Original strand, 19850045 - 19850093
Alignment:
| Q |
230 |
taatgcttatctcattaactagcaagaaacaatgatacctaatgctaca |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19850045 |
taatgcttatctcattaactagcaagaaacaatgatacctaaggctaca |
19850093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University