View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3493_low_23 (Length: 255)
Name: NF3493_low_23
Description: NF3493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3493_low_23 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 14 - 255
Target Start/End: Original strand, 11913250 - 11913494
Alignment:
| Q |
14 |
cacagacaaccataaagaaccaatataagttggccttgtatatgactaaattaacagaaaatcaagaca----ttacgttgttgcttgaatggaaggagt |
109 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11913250 |
cacaaacaaccataaagaaccaatataagttggccttgtatatgattaaatgaacagaaaatcaagacacaatttacgttgttgcttgaatggaaggagt |
11913349 |
T |
|
| Q |
110 |
ttgttttatcaaacaaattcttgtcaatttatttcaaaatgtattacaacaaccataatgaaaattcaattaagagattataagtagttcaccatgcaat |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11913350 |
ttgtttgatcaaacaaattcttgtcaatttatttcaaaatgtattacaacaaccataatgaaaatgcaattaagagattataagtagttcaccatgcaat |
11913449 |
T |
|
| Q |
210 |
taaatattgcaaacaagggaaatgacacaaatagttcctatgaatt |
255 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11913450 |
t-aatattgcaaacaagggaaatgacacaaatagttcctatgaatt |
11913494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University