View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3493_low_33 (Length: 215)
Name: NF3493_low_33
Description: NF3493
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3493_low_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 61 - 198
Target Start/End: Complemental strand, 4243753 - 4243616
Alignment:
| Q |
61 |
cagtttgatgaattgattgtgatagatttcctttttaaaagccaaatatatcttagtagaaaaatatgaaaaagactgattatgtgctagaagataataa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4243753 |
cagtttgatgaattgattgtgatagatttcctttttaaaagccaaatatatcttagtagaaaaatatgaaaaagactgattatgtgctagaagataataa |
4243654 |
T |
 |
| Q |
161 |
ataaatacatgcaagaccgattatggattggtttatgt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4243653 |
ataaatacatgcaagaccgattatggattggtttatgt |
4243616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 71 - 163
Target Start/End: Complemental strand, 4250966 - 4250876
Alignment:
| Q |
71 |
aattgattgtgatagatttcctttttaaaagccaaatatatcttagtagaaaaatatgaaaaagactgattatgtgctagaagataataaata |
163 |
Q |
| |
|
|||||| |||||| |||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4250966 |
aattgactgtgatggatttcctttttaaaagctaaatatat--tagtagaaaaatatgaaaaagactgattatgtgctagaagataataaata |
4250876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University