View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3494_low_10 (Length: 249)
Name: NF3494_low_10
Description: NF3494
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3494_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 43977103 - 43977169
Alignment:
| Q |
1 |
ttcttctagactactagagtttatgtttcttacatatcaagaaatggaagtcaaggacaaggacctc |
67 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43977103 |
ttcttctagactactagagtttctgtttcttacatgccaagaaatggaagtcaaggacaaggacctc |
43977169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 135 - 239
Target Start/End: Original strand, 43977236 - 43977337
Alignment:
| Q |
135 |
gagattggtaatagaggatttagttcattaaatctttgataataatttatctttagactttaaatgatatgatgaattgtgcttttggtttacatttctt |
234 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||| |||||||||||||||| |||||| ||||||| || |||||||||||||||||| |
|
|
| T |
43977236 |
gagattggtagcagaggatttagttcattaaacctttgataa---tttatctttagactttgaatgatgtgatgaactgaacttttggtttacatttctc |
43977332 |
T |
|
| Q |
235 |
ctctc |
239 |
Q |
| |
|
||||| |
|
|
| T |
43977333 |
ctctc |
43977337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University