View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3495_high_24 (Length: 253)

Name: NF3495_high_24
Description: NF3495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3495_high_24
NF3495_high_24
[»] chr3 (2 HSPs)
chr3 (119-253)||(3854264-3854400)
chr3 (16-52)||(3854212-3854248)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 119 - 253
Target Start/End: Original strand, 3854264 - 3854400
Alignment:
119 gtaatttaatagtgtgacttctagtcttgaactttatcaccga--tcaaaacacacacaatcnnnnnnnnatgtgtattctcaaaaaagcttgtgcatta 216  Q
    ||||||||||| |||||||||||||||| ||||||||||| ||  |||||||||||||||||        ||||||||||||||||||||||||||||||    
3854264 gtaatttaataatgtgacttctagtcttaaactttatcactgacatcaaaacacacacaatcttttttttatgtgtattctcaaaaaagcttgtgcatta 3854363  T
217 aagaccttgcacaatagaattcaatagaagttttgcc 253  Q
    |||||||||||||||||||||||||||||||||||||    
3854364 aagaccttgcacaatagaattcaatagaagttttgcc 3854400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 3854212 - 3854248
Alignment:
16 aggtgtgtgttcagcataagttgacgtgtgtcaaacg 52  Q
    ||||||||| |||||||||||||| ||||||||||||    
3854212 aggtgtgtgatcagcataagttgatgtgtgtcaaacg 3854248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University