View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3495_high_29 (Length: 244)

Name: NF3495_high_29

Description: NF3495

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF3495_high_29

[»] chr7 (1 HSPs)

[»] chr5 (1 HSPs)

Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 1)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 92; E-Value: 8e-45

Query Start/End: Original strand, 1 - 151

Target Start/End: Complemental strand, 5517875 - 5517720

Alignment:

Q	1	aaatagtataactgttctccatgcaaaggaattcagttttgttcggtaaattagcctactaaaatacacatccacccacataggataaaatatcttactg	100	Q
		\|\|\|\|\|\|\| \|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	5517875	aaatagtctaattgttctccatggaaaggaattcagttttgttcgataaattagcctactagaatacacatcctcccacataggataaaatatcttactg	5517776	T

Q	101	gttgttcaatcgaa-----caatgtatataactaaatcttgtttataataacacca	151	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	5517775	gttgttcgatcgaatgatgtattgtatataactcaatcttgattataataacacca	5517720	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)

Name: chr5

Description:

Target: chr5; HSP #1

Raw Score: 30; E-Value: 0.00000008

Query Start/End: Original strand, 56 - 133

Target Start/End: Complemental strand, 29718976 - 29718901

Alignment:

Q	56	ctactaaaatacacatccacccacataggataaaatatcttactggttgttcaatcgaacaatgtatataactaaatc	133	Q
		\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\| \|\|\|\|\|\|\|\| \|\|\|\|\|\|\| \|\|\|\|\|\| \|\|\|\|\|\|\|\| \| \|\|\|\|\|\|\|\|\|\|\|\|\| \|\|\|\|\| \|\|\|\|
T	29718976	ctactagattacacatcc-cccacatacgataaaacatcttattggttgttga-tcgaacaatgtatgtaactcaatc	29718901	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]