View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3495_low_12 (Length: 393)
Name: NF3495_low_12
Description: NF3495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3495_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 109 - 388
Target Start/End: Original strand, 31459189 - 31459467
Alignment:
| Q |
109 |
gaagtttattatcttagtaaacttttgttttgtagggatttgcaaggcacatccttggaaggcccaattcctcctgctgtatcggtcttgaaaaatttga |
208 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31459189 |
gaagtttattatctgaataaacttttgttttgtagggatttgcaaggcacatccttggaaggtccaattcctcctgctgtatcggtcttgaaaaatttga |
31459288 |
T |
 |
| Q |
209 |
aggaattgtgagtactttctctgtcatgattatcagtatcatacgctatttgaggctagtagatgaaatagcagcttataatttttctttgccaattact |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31459289 |
aggaattgtgagtactttctctgtcatgattatcagtatcgtacgc-atttgaggctagtagatgaaatagcagcttataatttttctttgccaattact |
31459387 |
T |
 |
| Q |
309 |
tttacttaatagtgtcatatatttaccagtagtttatcgatgattcataaatttttctttgaatatcgacctatgcttct |
388 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
31459388 |
tttacttaatagtgtcatatatttaccagtagtgtatcgatgattcataaatttttctttgaatatcgaccaatgtttct |
31459467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 31459106 - 31459151
Alignment:
| Q |
1 |
ttttatcggaaattggaccaaacttgaaagattgtgagtctaaatt |
46 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31459106 |
ttttattggaaactggaccaaacttgaaagattgtgagtctaaatt |
31459151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 256 - 306
Target Start/End: Complemental strand, 18026911 - 18026861
Alignment:
| Q |
256 |
atttgaggctagtagatgaaatagcagcttataatttttctttgccaatta |
306 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| || || |||||| |
|
|
| T |
18026911 |
atttgaggttagtagatgaaatagcagcttacaattttgctgtgtcaatta |
18026861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University