View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3495_low_24 (Length: 253)
Name: NF3495_low_24
Description: NF3495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3495_low_24 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 119 - 253
Target Start/End: Original strand, 3854264 - 3854400
Alignment:
| Q |
119 |
gtaatttaatagtgtgacttctagtcttgaactttatcaccga--tcaaaacacacacaatcnnnnnnnnatgtgtattctcaaaaaagcttgtgcatta |
216 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3854264 |
gtaatttaataatgtgacttctagtcttaaactttatcactgacatcaaaacacacacaatcttttttttatgtgtattctcaaaaaagcttgtgcatta |
3854363 |
T |
|
| Q |
217 |
aagaccttgcacaatagaattcaatagaagttttgcc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3854364 |
aagaccttgcacaatagaattcaatagaagttttgcc |
3854400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 3854212 - 3854248
Alignment:
| Q |
16 |
aggtgtgtgttcagcataagttgacgtgtgtcaaacg |
52 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
3854212 |
aggtgtgtgatcagcataagttgatgtgtgtcaaacg |
3854248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University