View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3495_low_25 (Length: 251)
Name: NF3495_low_25
Description: NF3495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3495_low_25 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 62 - 251
Target Start/End: Complemental strand, 5518044 - 5517857
Alignment:
| Q |
62 |
acaagagaagtttatgagttggttacaacaaaaataacttcatttcagaagttatcaaagactagaattttaagatcagaagaaacttgcaacggaaatt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
5518044 |
acaagagaagtttatgagttggttacaacaaaaataagttcatttcagaagttagcaaagactagaatttgaagatcagaagaaacttgcaacggaagtt |
5517945 |
T |
|
| Q |
162 |
tttaagtag--ttaagaagacatgtttcattcatacaaaacctaaagataattagtttcttttctttttctataaatagtataactgttctc |
251 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||| |||| ||||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
5517944 |
tttaagtagctataagaagacatgtttcattcatacaaaatctaaag----ttagattcttctctttttctataaatagtctaattgttctc |
5517857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University