View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3495_low_29 (Length: 244)

Name: NF3495_low_29
Description: NF3495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3495_low_29
NF3495_low_29
[»] chr7 (1 HSPs)
chr7 (1-151)||(5517720-5517875)
[»] chr5 (1 HSPs)
chr5 (56-133)||(29718901-29718976)


Alignment Details
Target: chr7 (Bit Score: 92; Significance: 8e-45; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 5517875 - 5517720
Alignment:
1 aaatagtataactgttctccatgcaaaggaattcagttttgttcggtaaattagcctactaaaatacacatccacccacataggataaaatatcttactg 100  Q
    ||||||| ||| ||||||||||| ||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||    
5517875 aaatagtctaattgttctccatggaaaggaattcagttttgttcgataaattagcctactagaatacacatcctcccacataggataaaatatcttactg 5517776  T
101 gttgttcaatcgaa-----caatgtatataactaaatcttgtttataataacacca 151  Q
    ||||||| ||||||      | ||||||||||| ||||||| ||||||||||||||    
5517775 gttgttcgatcgaatgatgtattgtatataactcaatcttgattataataacacca 5517720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 133
Target Start/End: Complemental strand, 29718976 - 29718901
Alignment:
56 ctactaaaatacacatccacccacataggataaaatatcttactggttgttcaatcgaacaatgtatataactaaatc 133  Q
    |||||| | ||||||||| |||||||| ||||||| |||||| |||||||| | ||||||||||||| ||||| ||||    
29718976 ctactagattacacatcc-cccacatacgataaaacatcttattggttgttga-tcgaacaatgtatgtaactcaatc 29718901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University