View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3495_low_31 (Length: 238)
Name: NF3495_low_31
Description: NF3495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3495_low_31 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 40633812 - 40634045
Alignment:
| Q |
1 |
ttaaggccttgaaaaattccctttgttttgataaactgctaaaatattacttatatatgtatagtgttattatttgaacgtcacatttctaacaccgccg |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
40633812 |
ttaatgccttgaaaaattccctttgttttgataaattgctcaaatattacttatatatgtatagtgttatgatttgaacgtcacaattctaacaccgccg |
40633911 |
T |
 |
| Q |
101 |
atgtgattgaaagaaagaaaacaaatacataaaactcgaaatcttatgtttatatagtatccgacaatatttgttgtcaatatattttctattgtttaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40633912 |
atgtgattgaaagaaagaaaacaaatacataaaactcgaaatcttatgtttatatagtatccgacaatatttgttgtcaatatattttctattgtttaat |
40634011 |
T |
 |
| Q |
201 |
ttgtcatcactcaaactgtaaccttcttctcact |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
40634012 |
ttgtcatcactcaaactgtaaccttcttttcact |
40634045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University