View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3495_low_33 (Length: 237)
Name: NF3495_low_33
Description: NF3495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3495_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 5 - 212
Target Start/End: Original strand, 3854553 - 3854760
Alignment:
| Q |
5 |
atcctcttattgcttcatgaatcatgccttttatgatatattatagcatgttgacctcatatcacttcacaacttattaactattaattatttaattgtt |
104 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
3854553 |
atccttttattgattcatgaatcatgccttttatgatatattatagcatgttcacctcatatcacttcacaacttgttaactattaattatttaactgtt |
3854652 |
T |
 |
| Q |
105 |
tcttgagatctcagatatcatttaaatcgggttaccattgtgagtgattgacttttccatagaccctagttccatcttaatggacgtgttatgaaatttc |
204 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
3854653 |
tcttgagatctcagacgtcatttaaatcgggttaccatcatgagtgattgacttttccgtagaccctagttccatcttaatggacgtgttgtgaaatttc |
3854752 |
T |
 |
| Q |
205 |
tctctaac |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
3854753 |
tctctaac |
3854760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 32 - 79
Target Start/End: Complemental strand, 16452880 - 16452833
Alignment:
| Q |
32 |
cttttatgatatattatagcatgttgacctcatatcacttcacaactt |
79 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16452880 |
cttttatgatttattatagcatgttcacctcatatcacttcacaactt |
16452833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 5496423 - 5496495
Alignment:
| Q |
7 |
cctcttattgcttcatgaatcatgccttttatgatatattatagcatgttgacctcatatcacttcacaactt |
79 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5496423 |
cctcttattgcttcaggaatcatgcctcttatgatttattatagcatgttcccctcatatcacttcacaactt |
5496495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 7 - 79
Target Start/End: Original strand, 19950983 - 19951055
Alignment:
| Q |
7 |
cctcttattgcttcatgaatcatgccttttatgatatattatagcatgttgacctcatatcacttcacaactt |
79 |
Q |
| |
|
|||||||| |||||| ||||||| ||| ||||||| |||||||||||||| || ||||||||||||||||||| |
|
|
| T |
19950983 |
cctcttatcgcttcaggaatcattcctcttatgatttattatagcatgttcacttcatatcacttcacaactt |
19951055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 32 - 79
Target Start/End: Complemental strand, 4540974 - 4540927
Alignment:
| Q |
32 |
cttttatgatatattatagcatgttgacctcatatcacttcacaactt |
79 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4540974 |
cttttatgatttattatagcatgttcacctcatatcacttcacaactt |
4540927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 7 - 79
Target Start/End: Complemental strand, 41318892 - 41318820
Alignment:
| Q |
7 |
cctcttattgcttcatgaatcatgccttttatgatatattatagcatgttgacctcatatcacttcacaactt |
79 |
Q |
| |
|
|||||||| ||||| || |||||||| ||||||| |||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
41318892 |
cctcttatcgcttcgggagtcatgcctcttatgatttattatagcatgttcacctcataccacttcacaactt |
41318820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University