View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3495_low_36 (Length: 236)
Name: NF3495_low_36
Description: NF3495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3495_low_36 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 23654768 - 23654986
Alignment:
| Q |
18 |
tttattaagtagtatctagtgnnnnnnntgtaaaatattgcattaagcaagttaattatgtcatggtcatgtctagaaggataagacaaaactaatgaag |
117 |
Q |
| |
|
||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23654768 |
tttatgaagtagtatctagtgaaaaaaatgtaaaatattgcattaagcaagttaattatgtcatggtcatgtctagaaggataagacaaaactaatgaag |
23654867 |
T |
 |
| Q |
118 |
taaattgaattaagaaatttacttgaagaattgtgtcatggtcacgtttagatgaatatgaatcccattgagaaaatcccttatgctttaaacgtgcttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23654868 |
taaattgaattaagaaatttacttgaagaattgtgtcatggtcacgtttagatgaatatgaatcccattgagaaaatcccttatgctttaaacgtgcttc |
23654967 |
T |
 |
| Q |
218 |
ttggggtactctttttaac |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
23654968 |
ttggggtactctttttaac |
23654986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 141 - 206
Target Start/End: Original strand, 23628402 - 23628467
Alignment:
| Q |
141 |
tgaagaattgtgtcatggtcacgtttagatgaatatgaatcccattgagaaaatcccttatgcttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||| |
|
|
| T |
23628402 |
tgaagaattgtgtcatggtcacgtttagatgaatatgaaccccattcagaaaactccttatgcttt |
23628467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 141 - 206
Target Start/End: Original strand, 23641011 - 23641076
Alignment:
| Q |
141 |
tgaagaattgtgtcatggtcacgtttagatgaatatgaatcccattgagaaaatcccttatgcttt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||||| |
|
|
| T |
23641011 |
tgaagaattgtgtcatggtcacgtttagatgaatatgaaccccattcagaaaactccttatgcttt |
23641076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University