View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3495_low_6 (Length: 470)
Name: NF3495_low_6
Description: NF3495
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3495_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 7e-44; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 264 - 414
Target Start/End: Complemental strand, 48872295 - 48872146
Alignment:
| Q |
264 |
atagtagtgttatgattgtgttctgttcagttcagttcatgctgtagcagttcagtttgaatatgtgaaagaagatgcagttttcatgagccactgttag |
363 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
48872295 |
atagtagtgttatgactgtgttctgtttagttcagttcatgctgtagcagttcagtttgaaaatgtgaaagctgatgcagttttcataaaccactgttag |
48872196 |
T |
|
| Q |
364 |
tccttttcactttgcaagtcagtttttataaagcatgcatacaaaactaat |
414 |
Q |
| |
|
|| | ||||||||||||||||| ||||||||| ||| || |||||||||| |
|
|
| T |
48872195 |
tcttcttcactttgcaagtcag-ttttataaatgatgtatgcaaaactaat |
48872146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 264 - 414
Target Start/End: Complemental strand, 48877599 - 48877450
Alignment:
| Q |
264 |
atagtagtgttatgattgtgttctgttcagttcagttcatgctgtagcagttcagtttgaatatgtgaaagaagatgcagttttcatgagccactgttag |
363 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| | |||||||||| |
|
|
| T |
48877599 |
atagtagtgttatgactgtgttctgtttagttcagttcatgctgtagcagttcagtttgaaaatgtgaaagctgatgcagttttcataaaccactgttag |
48877500 |
T |
|
| Q |
364 |
tccttttcactttgcaagtcagtttttataaagcatgcatacaaaactaat |
414 |
Q |
| |
|
|| | ||||||||||||||||| ||||||||| ||| || |||||||||| |
|
|
| T |
48877499 |
tcttcttcactttgcaagtcag-ttttataaatgatgtatgcaaaactaat |
48877450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 339 - 414
Target Start/End: Complemental strand, 48887930 - 48887856
Alignment:
| Q |
339 |
tgcagttttcatgagccactgttagtccttttcactttgcaagtcagtttttataaagcatgcatacaaaactaat |
414 |
Q |
| |
|
|||||||||||| | |||||||||||| | ||||||||||||||||| ||||||||| |||| || |||||||||| |
|
|
| T |
48887930 |
tgcagttttcataaaccactgttagtcttcttcactttgcaagtcag-ttttataaatcatgtatgcaaaactaat |
48887856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 287 - 363
Target Start/End: Complemental strand, 7491249 - 7491173
Alignment:
| Q |
287 |
tgttcagttcagttcatgctgtagcagttcagtttgaatatgtgaaagaagatgcagttttcatgagccactgttag |
363 |
Q |
| |
|
||||||||| ||||||||||||||||||| || ||| | ||||||||| | ||||| |||||| | ||||| |||| |
|
|
| T |
7491249 |
tgttcagtttagttcatgctgtagcagtttagattgtaaatgtgaaagctggtgcagatttcataatccactattag |
7491173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University