View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3496_high_1 (Length: 673)
Name: NF3496_high_1
Description: NF3496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3496_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 110; Significance: 4e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 202 - 398
Target Start/End: Complemental strand, 33615582 - 33615385
Alignment:
| Q |
202 |
ttccatttttcacattccaaaccagtactcaaaatttttgtt-gctttgaaaaattgtactgatggagaaggcttttcattctgtttatgagattgcaac |
300 |
Q |
| |
|
|||| ||||||||||||||||||| || |||| |||||| ||||| ||||||||| |||||||||||| |||||||||| || | ||||||||| || |
|
|
| T |
33615582 |
ttccgtttttcacattccaaaccacaacaaaaaaaatttgttcgctttaaaaaattgtgctgatggagaagccttttcattccgtgtctgagattgccac |
33615483 |
T |
|
| Q |
301 |
cggtaaggatggattgaaaatcaaggttcgtgtattgaggctttgggaggtgcctgcttttctcaacccagatcagacaaactctgtagagatggttc |
398 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
33615482 |
tggtaaggatggatggaaaatcaaggttcgtgttctgaggctttgggaggtgcctgcttttctcaacccagatcaaacaaactctgttgagatggttc |
33615385 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 519 - 652
Target Start/End: Complemental strand, 33615288 - 33615155
Alignment:
| Q |
519 |
cagggtaccaagattcatgccagtgttaggaagcaacttctttatgttttccaaagcaagttgaatgaggggaaggtttatcagatgtcatgtttctatg |
618 |
Q |
| |
|
|||||||||||||| |||||| |||| |||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| || |
|
|
| T |
33615288 |
cagggtaccaagatccatgccggtgtgaggaagcagcttctttatgttttccaaagcaagttgagcgagggaaaggtttatcagatgtcatgtttctctg |
33615189 |
T |
|
| Q |
619 |
ttgctccaagtgttggttcatatcgcaccacctc |
652 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
33615188 |
ttgctccaagtgttggttcttatcgcaccacctc |
33615155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 97; Significance: 2e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 198 - 418
Target Start/End: Original strand, 33436093 - 33436313
Alignment:
| Q |
198 |
tgtgttccatttttcacattccaaaccagtactcaaaatttttgttgctttgaaaaattgtactgatggagaaggcttttcattctgtttatgagattgc |
297 |
Q |
| |
|
|||||| | ||||||||||||||||||| || || ||||||||||||| | ||||| | |||||||||||| ||||||||| || | ||||||||| |
|
|
| T |
33436093 |
tgtgtttcgtttttcacattccaaaccaccaccaaatttttttgttgctttcagaaattttgctgatggagaagctttttcattccgtgtctgagattgc |
33436192 |
T |
|
| Q |
298 |
aaccggtaaggatggattgaaaatcaaggttcgtgtattgaggctttgggaggtgcctgcttttctcaacccagatcagacaaactctgtagagatggtt |
397 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||| | ||||||||| |
|
|
| T |
33436193 |
cctcggtgaggatggatggaaaatcaaggttcgtgttttgaggctttgggaggtgccctcttttctcaagccagatcagacaaactcccttgagatggtt |
33436292 |
T |
|
| Q |
398 |
cttattgatgagaaggttcgt |
418 |
Q |
| |
|
||||| ||||||| ||||||| |
|
|
| T |
33436293 |
cttatcgatgagatggttcgt |
33436313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 6e-42
Query Start/End: Original strand, 519 - 650
Target Start/End: Original strand, 33436408 - 33436539
Alignment:
| Q |
519 |
cagggtaccaagattcatgccagtgttaggaagcaacttctttatgttttccaaagcaagttgaatgaggggaaggtttatcagatgtcatgtttctatg |
618 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||| |||||||||||||||||||||||| ||||| ||||| ||| ||||||| ||||||| || |
|
|
| T |
33436408 |
cagggtaccaagatccatgccagtgtgaggaagcaacttttttatgttttccaaagcaagttgagcgagggaaaggtctatgagatgtcctgtttctctg |
33436507 |
T |
|
| Q |
619 |
ttgctccaagtgttggttcatatcgcaccacc |
650 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |
|
|
| T |
33436508 |
ttgctccaagtgttggttcttatcgcaccacc |
33436539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 55211303 - 55211346
Alignment:
| Q |
16 |
agtacaagatatgagagatacttttgttccattgattttttaaa |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
55211303 |
agtacaagatatgagagatacttttgttccattgatttgttaaa |
55211346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 346 - 414
Target Start/End: Complemental strand, 18354415 - 18354347
Alignment:
| Q |
346 |
ggaggtgcctgcttttctcaacccagatcagacaaactctgtagagatggttcttattgatgagaaggt |
414 |
Q |
| |
|
|||||| ||| |||| || ||||| |||||| |||||||| | |||||||| ||||||||||||||||| |
|
|
| T |
18354415 |
ggaggtaccttctttcctgaaccctgatcagccaaactctttggagatggtgcttattgatgagaaggt |
18354347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University