View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3496_high_12 (Length: 254)
Name: NF3496_high_12
Description: NF3496
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3496_high_12 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 254
Target Start/End: Original strand, 10760108 - 10760351
Alignment:
| Q |
11 |
gtgagatgaagcaacccaaagaacattactattacatttttcttctcgttttgggtttctctcatgaaagatcatagaaaacatagcagagccatttcat |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760108 |
gtgacatgaagcaacccaaagaacattactattacatttttcttctcgttttgggtttctctcatgaaagatcatagaaaacatagcagagccatttcat |
10760207 |
T |
 |
| Q |
111 |
ggagcacattcttctggttcactattgtggttgtcttatcttccattatctttacctccctaattatttcatccatccaccccttctacctccctcgatt |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760208 |
ggagcacattcttttggttcactattgtggttgtcttatcttccattatctttacctccctaattatttcatccatccaccccttctacctccctcgatt |
10760307 |
T |
 |
| Q |
211 |
tcacatcccaattgcagctttgaaatggccaactccagtgccac |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10760308 |
tcacatcccaattgcagctttgaaatggccaactccagtgccac |
10760351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University